View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12044_low_15 (Length: 240)
Name: NF12044_low_15
Description: NF12044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12044_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 8141519 - 8141740
Alignment:
| Q |
18 |
acaccaattttttcacaccatagatcgaagatttaaattgcagttgcagttacgttgtgattctctatatcataacaaatcgcagataaatgcgaacttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8141519 |
acaccaattttttcacaccatagatcgaagatttaaattgcagttgcagttacgttgtgattctctatatcataacaaatcgcagataaatgcgaccttt |
8141618 |
T |
 |
| Q |
118 |
gaaaccacaataactatattgtaatctctaatttgaaatcaatccttaaatataatattttgtatagacattaataaaagtgtaaacaatatcatacaat |
217 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8141619 |
gaagccacaataactatattgtaatctttaatttgaaatcaatccttaaatataatattttgtatagacattaataaaagtgtaaacaatatcatacaat |
8141718 |
T |
 |
| Q |
218 |
gttttgggttatttcttaccta |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8141719 |
gttttgggttatttcttaccta |
8141740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University