View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12044_low_9 (Length: 273)
Name: NF12044_low_9
Description: NF12044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12044_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 27916915 - 27917066
Alignment:
| Q |
1 |
tggtaattgaccaagttgaaattgtctttttgcattaggtagaagcaatcacttcttatacgtgaagctgaaataactt--tctatataagtcgaatcaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
27916915 |
tggtaattgaccaagttgaaattgtctttttgcattaggtagaagcaataacttcttatacgtgaagctgaaataactttatatatataagtcgaatcaa |
27917014 |
T |
 |
| Q |
99 |
atataacttgttgtacccaaaaaagttatataacttgatgtcgtatgtgtaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27917015 |
atataacttgttgtacccaaaaaagttatataacttgatgtcgtatgtgtaa |
27917066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 148 - 223
Target Start/End: Original strand, 27917128 - 27917202
Alignment:
| Q |
148 |
taaacatctataatttaaagaacattccataacttgtgtaatattgatgtctttggcatggggtttagcaattgtg |
223 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27917128 |
taaatatctataatttaaagaacattccataacttgtgtaatattgatgtc-ttggcatggggtttagcaattgtg |
27917202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University