View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12045_high_19 (Length: 241)
Name: NF12045_high_19
Description: NF12045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12045_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 24727018 - 24727232
Alignment:
| Q |
1 |
aaaaaacaatgaaacgtcctctctcttcctccatcctctgccttccttatttctccaagtccccactccgtcgttccctctcctccaccaccaccatccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24727018 |
aaaaaacaatgaaacgtcctctctcttcctccatcctctgccttccttatttctccaagtccccactccgtcgttccctctcctccaccaccaccatccc |
24727117 |
T |
 |
| Q |
101 |
tcttctgtctccggtgacggcggcggtgactaccaaaaa-ccccctttgtctcacccgcaaccaccattggccgctgccatggcctccctcactctccct |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
24727118 |
tcttctgtctccggtgacggcgg------ctaccaaaaacccccctttgtctcacccgcaaccaccattggctgctgccatggcctctctcactctccct |
24727211 |
T |
 |
| Q |
200 |
catcaaacatccttgtcatct |
220 |
Q |
| |
|
| ||||||||||||| ||||| |
|
|
| T |
24727212 |
cgtcaaacatccttgacatct |
24727232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University