View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12045_high_21 (Length: 219)
Name: NF12045_high_21
Description: NF12045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12045_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 22476024 - 22476204
Alignment:
| Q |
22 |
ttgatattgtctcctttattattactctgaaagctggcaatagtcaagtattgtagcttcatctttcggttgctctatataggagggcaaaatacctata |
121 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||| |||||| |||||||||||| |
|
|
| T |
22476024 |
ttgatattgtctactttattattactctgaaagctggcaacagtcaagtattgtagcttcat---tctgttgctctata--ggagggaaaaatacctata |
22476118 |
T |
 |
| Q |
122 |
tcatgcatttcatataaaaattgaaacacttgaaattggagtagtagatcatgcccattaaaaggaaaaggagtagagaataaaca |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22476119 |
tcatacatttcatataaaaattgaaacacttgaaattggagtagtagatcatgcccattaaaaggaaaaggagtagagaataaaca |
22476204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University