View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12045_high_6 (Length: 411)
Name: NF12045_high_6
Description: NF12045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12045_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 7499308 - 7499040
Alignment:
| Q |
1 |
tttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtgtctgattaacaaatgacatttgagccattggatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7499308 |
tttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtggctgattaacaaatgacatttgagccattggatga |
7499209 |
T |
 |
| Q |
101 |
aacctaggcaccacaaaaacatctccttgctgaactctaaacctcttgtttttgcatttgtcatcattgttgcttccacataccactcttaccattcctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499208 |
aacctaggcaccacaaaaacatctccttgctgaactctaaacctcttgtttttgcatttgtcatcattgttgcttccacataccactcttaccattcctt |
7499109 |
T |
 |
| Q |
201 |
ccccttccaacaccactgctacttctgttgccattggattccaatgtggccccaacattgatgcctttc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499108 |
ccccttccaacaccactgctacttctgttgccattggattccaatgtggccccaacattgatgcctttc |
7499040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 341 - 393
Target Start/End: Complemental strand, 7498968 - 7498916
Alignment:
| Q |
341 |
ttcataaagttataactttaactaataatgaaattatgatatggtcactgacc |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7498968 |
ttcataaagttataactttaactaataatgaaattatgatatggtcactgacc |
7498916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University