View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12045_low_11 (Length: 408)
Name: NF12045_low_11
Description: NF12045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12045_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 149 - 393
Target Start/End: Original strand, 28791414 - 28791657
Alignment:
| Q |
149 |
catatatagtgatttctttgcctctagaccttccactattatttttgaggcacaaaatatgacatttaccgatatacattcattaatagcctttagccat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28791414 |
catatatagtgatttctttgcctctagaccttccactattatttttgaggcacaaaatatgacatttaccgatatacattcattaatagcttttagccat |
28791513 |
T |
 |
| Q |
249 |
tcaaggtgtgcatcgaatcgcaatattaacagcaataaaggcaaagaaaacgaagtatgttcccgaagactattatagtgcaaccatgtttttctgctat |
348 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791514 |
tcaaggtgtgcatcgaatagcaatattaacagcaataaaggcaaag-aaacgaggtatgttcccgaagactattatagtgcaaccatgtttttctgctat |
28791612 |
T |
 |
| Q |
349 |
tcccctagctagctgctagcatcagtcggatattatactcgccac |
393 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791613 |
tcccctggctagctgctagcatcagtcggatattatactcgccac |
28791657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 28791284 - 28791374
Alignment:
| Q |
19 |
catagacgtaagcctgcctccaagagtagatgtgatctccggttttcagttgtttcctgtcaatcttattggaaagcacctccatcttaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28791284 |
catagacgtaagcctgcctccaagagtagatgtgatctccggttttcagttgtttcctatcaatcttattggaaagcacctccatcttaag |
28791374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 28784295 - 28784349
Alignment:
| Q |
19 |
catagacgtaagcctgcctccaagagtagatgtgatctccggttttcagttgttt |
73 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| | ||||| |||||| |
|
|
| T |
28784295 |
catagatgtaagcctgcctccaagagtagatgtgatctccagctttcaattgttt |
28784349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 215
Target Start/End: Original strand, 28787455 - 28787512
Alignment:
| Q |
160 |
atttctttgcctctagaccttccactat--tatttttgaggcacaaaatatgacattt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||| | |||||||||||| |
|
|
| T |
28787455 |
atttctttgcctctagaccttcccctattatatttttgaggcaaacaatatgacattt |
28787512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University