View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12045_low_16 (Length: 327)
Name: NF12045_low_16
Description: NF12045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12045_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 312
Target Start/End: Original strand, 28883547 - 28883843
Alignment:
| Q |
17 |
acaagaaataacgagatccggatacacgtttatgacagaagtgggccccatcgaaagtagca-atttcatttcaatttcaatctgcattgataaacaaaa |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28883547 |
acaagaaataacgagatccggatccacgtttattacagaagtgggccccatcgaaagtagcagatttcatttcaatttcaatctgcattgataaacaaaa |
28883646 |
T |
 |
| Q |
116 |
ccggaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccgttacggaggccttctatgtgccgttgtttcagcac |
215 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || || |||||||||| |
|
|
| T |
28883647 |
ccgcaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccgttacggcagccttctatgcgctgtcgtttcagcac |
28883746 |
T |
 |
| Q |
216 |
ttcttctcttaacaaccctctccttcctccgcagccacactcaccgcgttttcccctctcactctgtaaactacgattccctcctctccgattcatc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
28883747 |
ttcttctcttaacaaccctctccttcctccgtagccacactcaccgcgttttcccctctcactctgtaaattacgattctctcctctccgattcatc |
28883843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University