View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12046_high_9 (Length: 210)

Name: NF12046_high_9
Description: NF12046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12046_high_9
NF12046_high_9
[»] chr5 (2 HSPs)
chr5 (134-204)||(4976808-4976878)
chr5 (19-75)||(4976693-4976749)


Alignment Details
Target: chr5 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 134 - 204
Target Start/End: Original strand, 4976808 - 4976878
Alignment:
134 accctaaaaatgcgtttccttcttctccttttctttctcttccatttccactaccaccatgttctctctgc 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4976808 accctaaaaatgcgtttccttcttctccttttctttctcttccatttccactaccaccatgttctctctgc 4976878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 4976693 - 4976749
Alignment:
19 aacctcagtgggtggttcttcctaccctctctacccatacacactaatcgtgtgttg 75  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4976693 aacctcagtgggtggttcttcctaccctctctacccatacacactaatcgtgtgttg 4976749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University