View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12047_high_5 (Length: 240)
Name: NF12047_high_5
Description: NF12047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12047_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 19293736 - 19293518
Alignment:
| Q |
4 |
cttcaatgatgaatcttcaggcagtgacggcatttgtaattaggttgttccgaattatcagttacctctgtttctgtaagtaatgactagaatcnnnnnn |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19293736 |
cttcaatgatgaatcttcaggcagtgacggcatttgtaattaggttgttccgaattatcagttacttctgtttctgtaagtaatgactagaatcttttct |
19293637 |
T |
 |
| Q |
104 |
nnnnnngtgtttatgatacctgttatgaaattccattattgaattaagttcaaaatattatctgctaatttttatttgctagaaaagtttgtagactttt |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19293636 |
ttttt-gtgtttatgatacctgttatgcaattccattattgaattaagttcaaaatattatctgctaatttttatttgctagaaaagtttgtaaactttt |
19293538 |
T |
 |
| Q |
204 |
agatttccaactgatgtagc |
223 |
Q |
| |
|
||| ||||||| ||||||| |
|
|
| T |
19293537 |
agagttccaacctatgtagc |
19293518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University