View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12047_low_11 (Length: 230)
Name: NF12047_low_11
Description: NF12047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12047_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 43322964 - 43322734
Alignment:
| Q |
1 |
ctttataagagaagtgacacatattcacaaatcacaatgtcttaagattttggatatagctagttataatttgtggtcgttggtgaaccctgatcatcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
43322964 |
ctttataagagaagtgacacatattcataaatcacaatgtcttaagattttggatatatctaattataatttgtggtcattggtgagccccgatcatcat |
43322865 |
T |
 |
| Q |
101 |
taaccc-tttgttgctcccgatgttttcctaatttctttaaggagacactaactcatatacctaatatattaaagttttatgtgaaaatgtgatcattan |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
43322864 |
taacccttttgttgctcccgatgttttcctaatttctttaaggagacactaactcatatacctaatacattaaagttttatgtgaaaatgtgatcgttat |
43322765 |
T |
 |
| Q |
200 |
nnnnnnnngtattttaggatcattagtttgt |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43322764 |
ttttttttgtattttaggatcattagtttgt |
43322734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University