View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12047_low_4 (Length: 260)

Name: NF12047_low_4
Description: NF12047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12047_low_4
NF12047_low_4
[»] chr5 (1 HSPs)
chr5 (12-260)||(19293941-19294189)


Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 19294189 - 19293941
Alignment:
12 agagaggagggaatttagttattgttgctaacatgtatgctgaagtaggaaattgggagaaagcggcgaatgtgaggagggtaatgagagatggagggtt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
19294189 agagaggagggaatttagttattgttgctaacatgtatgctgaagtaggaaattgggagaaagcggcgaatgtgaggagggtaatgagagacggagggtt 19294090  T
112 gaagaaaatggctggagagagttgtgttgatttgggtggttccatgtataggttctttgctgggcatgattctcgcccggatttgatgcctgtctatgat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19294089 gaagaaaatggctggagagagttgtgttgatttgggtggttccatgtataggttctttgctgggcatgattctcgcccggatttgatgcctgtctatgat 19293990  T
212 ctgctagacacattgaacctgcacttgaagatggttcactagttttatt 260  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||    
19293989 ctgctagacgcattgaacctgcacttgaagatggttcactagttttatt 19293941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University