View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12047_low_8 (Length: 239)
Name: NF12047_low_8
Description: NF12047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12047_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 41 - 223
Target Start/End: Complemental strand, 42028449 - 42028267
Alignment:
| Q |
41 |
gtgtgtaggtactaaagctaaccatatatgctcatatctgtaaaacaactaaatttcaaaggaattagtatatgaataaacaagagttaatcatattaac |
140 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42028449 |
gtgtgtaggtagtaaagctaaccatatatgctcatatatgtaaaacaactaaatttcaaaggaattagtatatgaataaacaagagttaatcatattaac |
42028350 |
T |
|
| Q |
141 |
tcttttcttttctaaattcttttaaaagtgatcatgcgcagctcacattatgatgcttccgctatctttgcatgccctatatc |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42028349 |
tcttttcttttctaatttcttttaaaagtgatcatgtgcagctcacattatgatgcttccactatctttgcatgccctatatc |
42028267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 42029378 - 42029329
Alignment:
| Q |
1 |
tcaggttcatgaaattgtaagataccaaatcagtgataaggtgtgtaggt |
50 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42029378 |
tcaggttcatgaaattgtaagatgccaaatcagtgataaggtgtgtaggt |
42029329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University