View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12048_high_13 (Length: 254)
Name: NF12048_high_13
Description: NF12048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12048_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 32453744 - 32453504
Alignment:
| Q |
1 |
gtgctttttcataattaattaaaatcgannnnnnnn-cctcctaaaagcatgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttca |
99 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32453744 |
gtgctttttcagaattaattaaaatcgatttttttttcctcctaaaagcatgggtggtagaaacaaggagttgctgctgctgataatgcttgccttttca |
32453645 |
T |
|
| Q |
100 |
gttggtggcatcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcgg |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32453644 |
gttggtggcgtcaacaccagatcggattccgactgcaaatttggagcttttagattcaaatgtggcggtggtcggagacaacgtcgtggttcagtggcgg |
32453545 |
T |
|
| Q |
200 |
tggaaaaacagtctgggtggggtttctttggttccgttcat |
240 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32453544 |
tggacaaacggtctgggtggggtttctttggttccgttcat |
32453504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 110 - 240
Target Start/End: Original strand, 31670333 - 31670463
Alignment:
| Q |
110 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| ||| | |
|
|
| T |
31670333 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
31670432 |
T |
|
| Q |
210 |
gtctgggtggggtttctttggttccgttcat |
240 |
Q |
| |
|
|| ||| |||||||| ||||||| |||||| |
|
|
| T |
31670433 |
gtttggatggggtttgcttggttctgttcat |
31670463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 49 - 240
Target Start/End: Complemental strand, 36570772 - 36570578
Alignment:
| Q |
49 |
atgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttcagttggtggca---tcaacaccagatcggattccgactgcaaatttggag |
145 |
Q |
| |
|
|||||| |||||||||||||||||| | ||||||||||| |||| |||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36570772 |
atgggtagtagaaacaaggagttgtggatgctgataatgtttgctttttcagttggtggtggtgtcaacaccagatcggattctgactgcaaatttggag |
36570673 |
T |
|
| Q |
146 |
cttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaacagtctgggtggggtttctttggttccgttcat |
240 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| ||| | |||||||||||| |||||| ||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
36570672 |
ctttaagattcaaacatggcggtggtcggagacaacatggtggttcagtggtggtggacaaaaagtctgggtggggtttgtttggttctgttcat |
36570578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 49 - 177
Target Start/End: Original strand, 52603837 - 52603968
Alignment:
| Q |
49 |
atgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttcagttggtggca---tcaacaccagatcggattccgactgcaaatttggag |
145 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
52603837 |
atgggtagtagaaacaaggagttgtggctgttgataatgtttgccttttcagttggtggtggggtcaacaccagaacggattctgactgcaaatttggag |
52603936 |
T |
|
| Q |
146 |
cttttagattcaaacgtggcggtggtcggaga |
177 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| |
|
|
| T |
52603937 |
ctttaagattcaaacatggcggtggtcggaga |
52603968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 240
Target Start/End: Original strand, 52603975 - 52604017
Alignment:
| Q |
198 |
ggtggaaaaacagtctgggtggggtttctttggttccgttcat |
240 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
52603975 |
ggtggacaaacagtctgggtggggtttgtttggttctgttcat |
52604017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 110 - 240
Target Start/End: Original strand, 35987066 - 35987196
Alignment:
| Q |
110 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| ||| | |
|
|
| T |
35987066 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
35987165 |
T |
|
| Q |
210 |
gtctgggtggggtttctttggttccgttcat |
240 |
Q |
| |
|
|| ||| |||||||| ||||||| |||||| |
|
|
| T |
35987166 |
gtttggatggggtttgcttggttctgttcat |
35987196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 110 - 240
Target Start/End: Original strand, 36008474 - 36008604
Alignment:
| Q |
110 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| ||| | |
|
|
| T |
36008474 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
36008573 |
T |
|
| Q |
210 |
gtctgggtggggtttctttggttccgttcat |
240 |
Q |
| |
|
|| ||| |||||||| ||||||| |||||| |
|
|
| T |
36008574 |
gtttggatggggtttgcttggttctgttcat |
36008604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 110 - 240
Target Start/End: Complemental strand, 33047192 - 33047061
Alignment:
| Q |
110 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtgga-aaaac |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
33047192 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
33047093 |
T |
|
| Q |
209 |
agtctgggtggggtttctttggttccgttcat |
240 |
Q |
| |
|
||| ||| |||||||| ||||||| |||||| |
|
|
| T |
33047092 |
agtttggatggggtttgcttggttctgttcat |
33047061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University