View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12048_high_16 (Length: 243)
Name: NF12048_high_16
Description: NF12048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12048_high_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 23 - 243
Target Start/End: Original strand, 13710320 - 13710529
Alignment:
| Q |
23 |
tgtcaagaatggaccgaataaatagtgatacttagattgctatcaaaaacttattcttttgaataactttaattataaaaatcttattatgaatttgcaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||| |
|
|
| T |
13710320 |
tgtcaagaatggaccgaataaatagtgatacttagattggtatcaaaaacttattcttttgaataaccttaatcataaaaatcttattatgaatttccaa |
13710419 |
T |
 |
| Q |
123 |
caaggaatacccatggcactcaaaatctaaggatatgactttatcatctatcaattctttttcctgatatatatatagcttgttggtaataaattagtag |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| || ||||||||| ||||||||| |||||| |||||||||||||||||||||| ||| |
|
|
| T |
13710420 |
caagaaatacccatggcactcaaaatctaaggatctgcctttatcatatatcaattc---ttcctg--------atagcttgttggtaataaattaatag |
13710508 |
T |
 |
| Q |
223 |
gaatagtgtacttggaagttt |
243 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13710509 |
gaatagtgtacttggaagttt |
13710529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University