View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12048_low_13 (Length: 254)

Name: NF12048_low_13
Description: NF12048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12048_low_13
NF12048_low_13
[»] chr6 (2 HSPs)
chr6 (1-240)||(32453504-32453744)
chr6 (110-240)||(31670333-31670463)
[»] chr4 (1 HSPs)
chr4 (49-240)||(36570578-36570772)
[»] chr3 (2 HSPs)
chr3 (49-177)||(52603837-52603968)
chr3 (198-240)||(52603975-52604017)
[»] chr7 (2 HSPs)
chr7 (110-240)||(35987066-35987196)
chr7 (110-240)||(36008474-36008604)
[»] chr5 (1 HSPs)
chr5 (110-240)||(33047061-33047192)


Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 32453744 - 32453504
Alignment:
1 gtgctttttcataattaattaaaatcgannnnnnnn-cctcctaaaagcatgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttca 99  Q
    ||||||||||| ||||||||||||||||         |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
32453744 gtgctttttcagaattaattaaaatcgatttttttttcctcctaaaagcatgggtggtagaaacaaggagttgctgctgctgataatgcttgccttttca 32453645  T
100 gttggtggcatcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcgg 199  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||    
32453644 gttggtggcgtcaacaccagatcggattccgactgcaaatttggagcttttagattcaaatgtggcggtggtcggagacaacgtcgtggttcagtggcgg 32453545  T
200 tggaaaaacagtctgggtggggtttctttggttccgttcat 240  Q
    |||| |||| |||||||||||||||||||||||||||||||    
32453544 tggacaaacggtctgggtggggtttctttggttccgttcat 32453504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 110 - 240
Target Start/End: Original strand, 31670333 - 31670463
Alignment:
110 tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca 209  Q
    |||||||||||||||||||| | ||||||||||||||| | ||||||||||  ||||||| ||||||| |||   ||||||||||||||||||| ||| |    
31670333 tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa 31670432  T
210 gtctgggtggggtttctttggttccgttcat 240  Q
    || ||| ||||||||  ||||||| ||||||    
31670433 gtttggatggggtttgcttggttctgttcat 31670463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 49 - 240
Target Start/End: Complemental strand, 36570772 - 36570578
Alignment:
49 atgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttcagttggtggca---tcaacaccagatcggattccgactgcaaatttggag 145  Q
    |||||| |||||||||||||||||| | ||||||||||| |||| ||||||||||||||     ||||||||||||||||||| ||||||||||||||||    
36570772 atgggtagtagaaacaaggagttgtggatgctgataatgtttgctttttcagttggtggtggtgtcaacaccagatcggattctgactgcaaatttggag 36570673  T
146 cttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaacagtctgggtggggtttctttggttccgttcat 240  Q
    |||| |||||||||| |||||||||||||||| ||| | |||||||||||| |||||| ||| |||||||||||||||| |||||||| ||||||    
36570672 ctttaagattcaaacatggcggtggtcggagacaacatggtggttcagtggtggtggacaaaaagtctgggtggggtttgtttggttctgttcat 36570578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 49 - 177
Target Start/End: Original strand, 52603837 - 52603968
Alignment:
49 atgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttcagttggtggca---tcaacaccagatcggattccgactgcaaatttggag 145  Q
    |||||| |||||||||||||||||| |||| |||||||| |||||||||||||||||||     ||||||||||| ||||||| ||||||||||||||||    
52603837 atgggtagtagaaacaaggagttgtggctgttgataatgtttgccttttcagttggtggtggggtcaacaccagaacggattctgactgcaaatttggag 52603936  T
146 cttttagattcaaacgtggcggtggtcggaga 177  Q
    |||| |||||||||| ||||||||||||||||    
52603937 ctttaagattcaaacatggcggtggtcggaga 52603968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 240
Target Start/End: Original strand, 52603975 - 52604017
Alignment:
198 ggtggaaaaacagtctgggtggggtttctttggttccgttcat 240  Q
    |||||| |||||||||||||||||||| |||||||| ||||||    
52603975 ggtggacaaacagtctgggtggggtttgtttggttctgttcat 52604017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 110 - 240
Target Start/End: Original strand, 35987066 - 35987196
Alignment:
110 tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca 209  Q
    |||||||||||||||||||| | ||||||||||||||| | ||||||||||  ||||||| ||||||| |||   ||||||||||||||||||| ||| |    
35987066 tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa 35987165  T
210 gtctgggtggggtttctttggttccgttcat 240  Q
    || ||| ||||||||  ||||||| ||||||    
35987166 gtttggatggggtttgcttggttctgttcat 35987196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 110 - 240
Target Start/End: Original strand, 36008474 - 36008604
Alignment:
110 tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca 209  Q
    |||||||||||||||||||| | ||||||||||||||| | ||||||||||  ||||||| ||||||| |||   ||||||||||||||||||| ||| |    
36008474 tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa 36008573  T
210 gtctgggtggggtttctttggttccgttcat 240  Q
    || ||| ||||||||  ||||||| ||||||    
36008574 gtttggatggggtttgcttggttctgttcat 36008604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 110 - 240
Target Start/End: Complemental strand, 33047192 - 33047061
Alignment:
110 tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtgga-aaaac 208  Q
    |||||||||||||||||||| | ||||||||||||||| | ||||||||||  ||||||| ||||||| |||   ||||||||||||||||||| ||||     
33047192 tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa 33047093  T
209 agtctgggtggggtttctttggttccgttcat 240  Q
    ||| ||| ||||||||  ||||||| ||||||    
33047092 agtttggatggggtttgcttggttctgttcat 33047061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University