View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12049_high_24 (Length: 243)
Name: NF12049_high_24
Description: NF12049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12049_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 361167 - 360954
Alignment:
| Q |
19 |
aattgattgttcaggttgcttcaaccattgtgtattcagtcactggtggaaaatcacttaagaagttctgtgaaataatgactccaataatgccaatgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361167 |
aattgattgttcaggttgcttcaaccattgtgtattcagtcactggtggaaaatcacttaagaagttctgtgaaataatgactccaataatgccaatgtt |
361068 |
T |
|
| Q |
119 |
tgatgaaattagacaaacatattatatttgcttctttgtttgtatacagttactcctttcacaaattcctaacttcaatactttaaaaggaatctcgttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
361067 |
tgatgaaattagacaaacatattatatctgcttctttgtttgtatacagttactcctttcacaaattcctaacttcaatactttaaaaggaatctcgctg |
360968 |
T |
|
| Q |
219 |
ctcgcggcattcat |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
360967 |
ctcgcggcattcat |
360954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University