View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12049_high_31 (Length: 205)
Name: NF12049_high_31
Description: NF12049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12049_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 16 - 132
Target Start/End: Complemental strand, 32440306 - 32440190
Alignment:
| Q |
16 |
gagagggagcaaacttcatttatttccacatttaacaacaacatcaatgtcaacgaaggctctgtcatacaaaatgtggtagactcttacaacataacaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
32440306 |
gagagggagcaaacttcatttatttccacatttaacaacaacatcaatgtcaatgaaggctttgtcacacaaaatgtgctagactcttacaacatgacaa |
32440207 |
T |
 |
| Q |
116 |
actaaaattacaatatc |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32440206 |
actaaaattacaatatc |
32440190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University