View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12049_high_5 (Length: 551)
Name: NF12049_high_5
Description: NF12049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12049_high_5 |
 |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
| [»] scaffold0769 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0502 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 4e-33; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 386 - 539
Target Start/End: Original strand, 5354697 - 5354855
Alignment:
| Q |
386 |
gtttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacacttc-----nnn |
480 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5354697 |
gtttcaccgcccggcgaccccgggcggtcgcccgggctcgatccttaattttctcacattaggtccaacctataggcccatttacacacttcaaaaaaaa |
5354796 |
T |
 |
| Q |
481 |
nnnnnnngggcaaatacatcacacgcgtgacaaattcacaacacaaactctcgtctctg |
539 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
5354797 |
aaaaattgggcaaatacatcacacgcatcacaaattcacaacacaaactctcttctctg |
5354855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 376 - 428
Target Start/End: Original strand, 45182959 - 45183011
Alignment:
| Q |
376 |
atcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||| ||| |||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45182959 |
atcaagggcggtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
45183011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 378 - 428
Target Start/End: Original strand, 6890978 - 6891028
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| |||||||| ||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
6890978 |
caggggcggtttcaccgcccggcgacaccgggcggtcgcccgggctcgatc |
6891028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 378 - 428
Target Start/End: Complemental strand, 6931081 - 6931031
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
6931081 |
caggggcggtttcaccgcccggcgaccccggacggtcgcccgggctcgatc |
6931031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 379 - 427
Target Start/End: Original strand, 33040934 - 33040982
Alignment:
| Q |
379 |
aggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgat |
427 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||| || |||||||||| |
|
|
| T |
33040934 |
aggggcggtttcaccgcccggcgaccccgggcggtcgctcgggctcgat |
33040982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 72; Significance: 2e-32; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 398 - 538
Target Start/End: Original strand, 194028 - 194171
Alignment:
| Q |
398 |
ggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacacttcnnnnnnnnnn---gggcaaa |
494 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
194028 |
ggcgaccccgggcggtcgcccgggctcgatccgtaatttcctcacattaggcccaacctataggcccatttacacacttcaaaaaaaaaaaaggggcaaa |
194127 |
T |
 |
| Q |
495 |
tacatcacacgcgtgacaaattcacaacacaaactctcgtctct |
538 |
Q |
| |
|
|||||||||| | | ||||||||||||||||||| ||| ||||| |
|
|
| T |
194128 |
tacatcacacacatcacaaattcacaacacaaaccctcttctct |
194171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 2e-32; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 378 - 477
Target Start/End: Complemental strand, 26543952 - 26543853
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacacttc |
477 |
Q |
| |
|
|||||| ||||| || ||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26543952 |
caggggcggttttaccgcccggcgaccccgggcggtcgcccgggctcgatccgtaatttcctcacattaggcccaacatataggcccatttacacacttc |
26543853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 476
Target Start/End: Complemental strand, 31501903 - 31501805
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacactt |
476 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||| | |||||||||||||| |||||| |||||||| ||||||| | | ||| ||| |||||||| |
|
|
| T |
31501903 |
caggggcggtttcaccgcccggcgaccccgggcgattgcccgggctcgatcgataatttttgcacattagacccaacccaaaagccaattaacacactt |
31501805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 428
Target Start/End: Original strand, 31680347 - 31680397
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
31680347 |
caggggcggtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
31680397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 377 - 428
Target Start/End: Complemental strand, 17332739 - 17332688
Alignment:
| Q |
377 |
tcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||| | |||||||||||||| |
|
|
| T |
17332739 |
tcaggggcggtttcaccgcccggcgaccccgggcgttcgcccgggctcgatc |
17332688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 397 - 473
Target Start/End: Original strand, 39434695 - 39434771
Alignment:
| Q |
397 |
tggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacaca |
473 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||| ||||||||| | ||||| | | ||||||| ||||| |
|
|
| T |
39434695 |
tggcgaccctgggcggtcgcccgggctcgatcgataattttttcacattagactcaacccaaaagcccattaacaca |
39434771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 2e-32; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 378 - 477
Target Start/End: Original strand, 34523220 - 34523319
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacacttc |
477 |
Q |
| |
|
|||||| ||||| || ||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34523220 |
caggggcggttttaccgcccggcgaccccgggcggtcgcccgggctcgatccgtaatttcctcacattaggcccaacatataggcccatttacacacttc |
34523319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 415 - 476
Target Start/End: Original strand, 22466265 - 22466326
Alignment:
| Q |
415 |
gcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacactt |
476 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22466265 |
gcccgggctcgatccgtaatttcctcacattaggcccaacctatagacccatttacacactt |
22466326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 377 - 428
Target Start/End: Original strand, 8147330 - 8147381
Alignment:
| Q |
377 |
tcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
8147330 |
tcaggggcggtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
8147381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 428
Target Start/End: Original strand, 45418563 - 45418613
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45418563 |
caggggcggtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
45418613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 378 - 428
Target Start/End: Original strand, 26237937 - 26237987
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| ||||| || ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
26237937 |
caggggtggttttacagcccggcgaccccgggcggtcgcccgggctcgatc |
26237987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 379 - 428
Target Start/End: Complemental strand, 44084789 - 44084740
Alignment:
| Q |
379 |
aggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||| || |||||||||||||| |
|
|
| T |
44084789 |
aggggcggtttcaccgcccggcgaccccgggcagtcgcccgggctcgatc |
44084740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0769 (Bit Score: 70; Significance: 3e-31; HSPs: 1)
Name: scaffold0769
Description:
Target: scaffold0769; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 380 - 477
Target Start/End: Original strand, 1259 - 1356
Alignment:
| Q |
380 |
ggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacacttc |
477 |
Q |
| |
|
|||| ||||| || ||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1259 |
ggggcggttttaccgcccggcgaccccgggcggtcgcccgggctcgatccgtaatttcctcacattaggcccaacatataggcccatttacacacttc |
1356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 6e-23; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 28 - 95
Target Start/End: Complemental strand, 40316273 - 40316206
Alignment:
| Q |
28 |
gagcatcagacttccggtgagcaacatacgtcgaaactgagcatggaaaatcaccctgcaatgatgga |
95 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40316273 |
gagcatcagacttccggtgagcgtcatacgtcgaaactgagcatggaaaatcactctgcaatgatgga |
40316206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 28 - 95
Target Start/End: Complemental strand, 40326347 - 40326280
Alignment:
| Q |
28 |
gagcatcagacttccggtgagcaacatacgtcgaaactgagcatggaaaatcaccctgcaatgatgga |
95 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40326347 |
gagcatcagacttccggtgagcgtcatacgtcgaaactgagcatggaaaatcactctgcaatgatgga |
40326280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 377 - 428
Target Start/End: Complemental strand, 6690423 - 6690372
Alignment:
| Q |
377 |
tcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
6690423 |
tcaggggcggtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
6690372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 428
Target Start/End: Complemental strand, 49908839 - 49908789
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
49908839 |
caggggcggtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
49908789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 376 - 428
Target Start/End: Complemental strand, 5517553 - 5517501
Alignment:
| Q |
376 |
atcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
5517553 |
atcaggggcggtttcaccgcccggcgaccccgggcggtcgcctgggctcgatc |
5517501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 436
Target Start/End: Complemental strand, 36382513 - 36382474
Alignment:
| Q |
397 |
tggcgaccccgggcggtagcccgggctcgatccctaattt |
436 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
36382513 |
tggcgaccccgggcggtcgcccgggctcgatccataattt |
36382474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 228 - 295
Target Start/End: Complemental strand, 44728517 - 44728450
Alignment:
| Q |
228 |
ccatttctgatgcacacctttgacattaagattcaccatttgattgttgcatttgtgaacaaagtgtg |
295 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| | ||| | | ||||||||||||||||||||| |
|
|
| T |
44728517 |
ccatttctgatgcacactttggacattaagattcgtccttttgtagctgcatttgtgaacaaagtgtg |
44728450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 398 - 455
Target Start/End: Complemental strand, 30216909 - 30216852
Alignment:
| Q |
398 |
ggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacc |
455 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
30216909 |
ggcgaccccgggcggtcgcccgggctcgatcgataatttttgcacattagacccaacc |
30216852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 415 - 477
Target Start/End: Original strand, 12703 - 12765
Alignment:
| Q |
415 |
gcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacacttc |
477 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12703 |
gcccgggctcgatccgtaatttcctcacattaggcccaacatataggcccatttacacacttc |
12765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 423 - 477
Target Start/End: Complemental strand, 21977048 - 21976994
Alignment:
| Q |
423 |
tcgatccctaatttcctcacattaggcccaacctataggcccatttacacacttc |
477 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21977048 |
tcgatccgtaatttcctcacattaggcccaacatataggcccatttacacacttc |
21976994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 2154699 - 2154779
Alignment:
| Q |
20 |
cttccggcgagcatcagacttccggtgagcaacatacgtcgaaactgagcatggaaaatcaccctgcaatgatggaagatt |
100 |
Q |
| |
|
|||| |||||| ||| || ||| |||||| ||| |||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2154699 |
cttcaggcgagtatcggatttcaggtgagaaacgtacggcgaaaccgagcatggaaaatcagcctgcaatgatggaagatt |
2154779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 377 - 428
Target Start/End: Original strand, 23402087 - 23402138
Alignment:
| Q |
377 |
tcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
23402087 |
tcaggggcggtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
23402138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 377 - 428
Target Start/End: Original strand, 36408530 - 36408581
Alignment:
| Q |
377 |
tcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||||| |||||||| ||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
36408530 |
tcaggggtggtttcaccgcccggcgacctcgggcggtcgcccgggctcgatc |
36408581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 379 - 428
Target Start/End: Complemental strand, 2729382 - 2729333
Alignment:
| Q |
379 |
aggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2729382 |
aggggcggtttcaccgcccggcgaccccgggcggacgcccgggctcgatc |
2729333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000003; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 231 - 292
Target Start/End: Complemental strand, 21205685 - 21205624
Alignment:
| Q |
231 |
tttctgatgcacacctttgacattaagattcaccatttgattgttgcatttgtgaacaaagt |
292 |
Q |
| |
|
|||| |||||| ||||||||||||||| |||||||||| |||| ||||||| |||||||||| |
|
|
| T |
21205685 |
tttccgatgcatacctttgacattaaggttcaccatttcattgctgcatttatgaacaaagt |
21205624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 235 - 319
Target Start/End: Complemental strand, 21354575 - 21354489
Alignment:
| Q |
235 |
tgatgcacacctttgacattaagattcaccatttgattgttgcatttgtgaacaaag--tgtgtggaaaatttttggtggaattaaa |
319 |
Q |
| |
|
||||||||| ||| ||||||||| |||||| || |||| |||||| |||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
21354575 |
tgatgcacagcttggacattaaggttcacccttctattgctgcattagtgaacaaagtttgtgtggaaaaattctggtggaattaaa |
21354489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 24697997 - 24697906
Alignment:
| Q |
385 |
ggtttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacactt |
476 |
Q |
| |
|
|||||||| ||| ||||||||||| | | |||||||||| ||| |||||| ||||||||||||||||| | | ||||||| |||||||| |
|
|
| T |
24697997 |
ggtttcaccgcccggcgaccccggacactcgcccgggctcaatcgataattttttcacattaggcccaacccaaaagcccattaacacactt |
24697906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 378 - 457
Target Start/End: Original strand, 28996710 - 28996789
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaaccta |
457 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||| ||||| |||||||| |||||| | |||||| ||||||||| |
|
|
| T |
28996710 |
caggggcggtttcaccgcccggcgaccccgggcggtcgcccgagctcgatcgataatttttgcgcattagacccaaccta |
28996789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 378 - 428
Target Start/End: Original strand, 13646997 - 13647047
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||| |||||||||||||| |
|
|
| T |
13646997 |
caggggcggtttcaccacccggcgaccccgggcggtcgcccgggctcgatc |
13647047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 398 - 476
Target Start/End: Original strand, 18339106 - 18339184
Alignment:
| Q |
398 |
ggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacactt |
476 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| |||||||| ||||| ||| | ||| ||| |||||||| |
|
|
| T |
18339106 |
ggcgaccccgggcggtcgcccgggctcgatcaataatttttgcacattagacccaatctaaaagccaattaacacactt |
18339184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 378 - 428
Target Start/End: Complemental strand, 34385575 - 34385525
Alignment:
| Q |
378 |
caggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
34385575 |
caggggcggtttcaccgcccggcgaccccgggcggttgccctggctcgatc |
34385525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 228 - 264
Target Start/End: Complemental strand, 21305748 - 21305712
Alignment:
| Q |
228 |
ccatttctgatgcacacctttgacattaagattcacc |
264 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
21305748 |
ccatttctgatgcacaccttagacattaaggttcacc |
21305712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 376 - 428
Target Start/End: Original strand, 7002703 - 7002755
Alignment:
| Q |
376 |
atcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
7002703 |
atcaggggcggtttcaccgcccggcgaccccgagcggtcgcccgggctcgatc |
7002755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 376 - 428
Target Start/End: Original strand, 7048574 - 7048626
Alignment:
| Q |
376 |
atcaggggaggtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
7048574 |
atcaggggcggtttcaccgcccggcgaccccgagcggtcgcccgggctcgatc |
7048626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 387 - 455
Target Start/End: Complemental strand, 34389234 - 34389166
Alignment:
| Q |
387 |
tttcactgcctggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacc |
455 |
Q |
| |
|
|||||| ||| |||||||||||||||| |||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
34389234 |
tttcaccgcccggcgaccccgggcggtcgcccgggctcgatcgataatttttgcacattagacccaacc |
34389166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 386 - 428
Target Start/End: Complemental strand, 8867910 - 8867868
Alignment:
| Q |
386 |
gtttcactgcctggcgaccccgggcggtagcccgggctcgatc |
428 |
Q |
| |
|
||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
8867910 |
gtttcaccgcccggcgaccccgggcggtcgcccgggctcgatc |
8867868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 228 - 295
Target Start/End: Original strand, 1282 - 1349
Alignment:
| Q |
228 |
ccatttctgatgcacacctttgacattaagattcaccatttgattgttgcatttgtgaacaaagtgtg |
295 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||| ||| |||| |||||||||| || |||||| |
|
|
| T |
1282 |
ccatttctgatgcacagcttggacattaaggttcacccttttattgccgcatttgtgatcagagtgtg |
1349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0502 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0502
Description:
Target: scaffold0502; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 398 - 476
Target Start/End: Original strand, 5230 - 5308
Alignment:
| Q |
398 |
ggcgaccccgggcggtagcccgggctcgatccctaatttcctcacattaggcccaacctataggcccatttacacactt |
476 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| |||||||| ||||| ||| | ||| ||| |||||||| |
|
|
| T |
5230 |
ggcgaccccgggcggtcgcccgggctcgatcaataatttttgcacattagacccaatctaaaagccaattaacacactt |
5308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University