View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_105 (Length: 203)
Name: NF1204_high_105
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_105 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 23 - 203
Target Start/End: Complemental strand, 23767946 - 23767764
Alignment:
| Q |
23 |
agcttcatccacttttattgtattgagatccatattagaagnnnnnnnctt---aagattagaagcatcttgttaagaaagaagtgaaatgcaagaataa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23767946 |
agcttcatccacttttattgtattgagatccatattagaagtttttatcttcttaagattagaagcatcttgttaagaaagaagtgaaatgcaagaataa |
23767847 |
T |
 |
| Q |
120 |
tatgctaaaggaaataagttaaattaaattttgtctaaagagtcttgtttgtattacgattgattttcaaaccatcttctttgt |
203 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23767846 |
tatgctaaatgaaataagttaaattaaattttgtctaaa-agtcttgtttgtattacgattgattttcaaaccgtcttctttgt |
23767764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University