View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_43 (Length: 367)
Name: NF1204_high_43
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_43 |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0488 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 65 - 275
Target Start/End: Original strand, 34648 - 34858
Alignment:
| Q |
65 |
gggagaattgtatgtatattatttcttctatgaattattttgctactcatgtatttagagaggggaatgcatgtgctgattctctagccagtctaggatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34648 |
gggagaattgtatgtatattatttcttctatgaatttttttgctactcatgtatttagagaggggaatgcatgtgcagattctctagccagtctaggatt |
34747 |
T |
 |
| Q |
165 |
aactcttgatcaccttaagatttggtttgatgctcgtggctgtatcaagtcttccttagctaggaacaaaactgggatgccagagtatcgttttgtaact |
264 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34748 |
aactcttgatcaccttaagatttgatttgatgctcctggctgtatgaagtcttccttagctaggaacaaaactgggatgccagagtatcgttttgtaact |
34847 |
T |
 |
| Q |
265 |
ttctaaggagg |
275 |
Q |
| |
|
||||||||||| |
|
|
| T |
34848 |
ttctaaggagg |
34858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0488 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: scaffold0488
Description:
Target: scaffold0488; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 65 - 275
Target Start/End: Complemental strand, 5523 - 5313
Alignment:
| Q |
65 |
gggagaattgtatgtatattatttcttctatgaattattttgctactcatgtatttagagaggggaatgcatgtgctgattctctagccagtctaggatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5523 |
gggagaattgtatgtatattatttcttctatgaatttttttgctactcatatatttagagaggggaatgcatgtgctgattctctagccagtctaggttt |
5424 |
T |
 |
| Q |
165 |
aactcttgatcaccttaagatttggtttgatgctcgtggctgtatcaagtcttccttagctaggaacaaaactgggatgccagagtatcgttttgtaact |
264 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| || || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5423 |
atctcttgatcaccttaagatttggtttgatgctcctgactttattaagtcttccttagctaggaacaaaactgggatgccagagtatcgttttgtaact |
5324 |
T |
 |
| Q |
265 |
ttctaaggagg |
275 |
Q |
| |
|
||||||||||| |
|
|
| T |
5323 |
ttctaaggagg |
5313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 67 - 275
Target Start/End: Original strand, 6089711 - 6089919
Alignment:
| Q |
67 |
gagaattgtatgtatattatttcttctatgaattattttgctactcatgtatttagagaggggaatgcatgtgctgattctctagccagtctaggattaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6089711 |
gagaattgtatgtatattatttcttctatgattttttttgctactcatgtatttagagaggggaatgcatgtgctgattctctagccagtctagggctaa |
6089810 |
T |
 |
| Q |
167 |
ctcttgatcaccttaagatttggtttgatgctcgtggctgtatcaagtcttccttagctaggaacaaaactgggatgccagagtatcgttttgtaacttt |
266 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6089811 |
ctcttgatcaccttaagatttggttggatgctcctgactatatcaagtcttccttagctaggaacaaaactgggatgccagagtatcgttttgtaacttt |
6089910 |
T |
 |
| Q |
267 |
ctaaggagg |
275 |
Q |
| |
|
||||||||| |
|
|
| T |
6089911 |
ctaaggagg |
6089919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University