View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_48 (Length: 359)
Name: NF1204_high_48
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 14 - 332
Target Start/End: Original strand, 53345702 - 53346010
Alignment:
| Q |
14 |
agagagtatatcaattaaaagtgattatatctgcctctcttcccccttactccagcaacgtagaataattattatggagacaacaataattttttagagt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53345702 |
agagagtatatcaattaaaagtgattatatctgtctctcttcccccttactccagcaacgaagattaattattatggagacaacaataattttttagagt |
53345801 |
T |
|
| Q |
114 |
tatagacgcaaacatagcaaacaatatgattaccggatgtctaaaatgggatggagacatggagtgggttgaattacaaatataggttgaaattttcatc |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53345802 |
tatagacgcaaacatagcaaacagtatgattaccggatgtctaaaatgggatggagacatggagtgggttgaattacaaatataggttgaaattttcatc |
53345901 |
T |
|
| Q |
214 |
ctaccccacccggccacgggttgatccatcggtagcaaaacacaagaaaatatagctaatgcatgataatgaatttaattttactttcagattaaacatc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53345902 |
ctaccccacccggccacgggttgatccatcggtagcaaaacacaagaaaatatagctaatgcatgataatgaat----------tttcagattaaacatc |
53345991 |
T |
|
| Q |
314 |
acgtgtagtccttacagtg |
332 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53345992 |
acgtgtagtccttacagtg |
53346010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University