View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_52 (Length: 340)
Name: NF1204_high_52
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 135 - 255
Target Start/End: Original strand, 45211775 - 45211895
Alignment:
| Q |
135 |
atagggttatatgtgaaagcggagagtagggcagaaatgtttgtgaaatttccaggtgaatctgagttgtgagaaaaacaaacaaataaataatttagac |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45211775 |
atagggttatatgtgaaagcggagagtagggcagaaatgtttgtgaaatttccaggtgaatctgagttgtgagaaaaacaaacaaataaataatttagac |
45211874 |
T |
 |
| Q |
235 |
tgagaatgttagagagagata |
255 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45211875 |
tgagaatgttagagagagata |
45211895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University