View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1204_high_63 (Length: 307)

Name: NF1204_high_63
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1204_high_63
NF1204_high_63
[»] chr4 (2 HSPs)
chr4 (84-211)||(9451388-9451515)
chr4 (15-57)||(9451525-9451568)
[»] chr2 (1 HSPs)
chr2 (131-211)||(29280231-29280311)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 84 - 211
Target Start/End: Complemental strand, 9451515 - 9451388
Alignment:
84 atatgagcatggggaagagagtggatgaatttctgcatgagaacattaacaggcacgttggaaacacaacaatgaagatatgcgctattaaatgcattag 183  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||  | ||||||||||||||||    
9451515 atatgagcatggggaagagagtggattaatttctgcatgagaacattaacaggcatgttggaaacacgacaatgaagatagtccctattaaatgcattag 9451416  T
184 atacatgcattggcagactccacaggtt 211  Q
    ||| |||||||||||||||||| |||||    
9451415 atatatgcattggcagactccataggtt 9451388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 9451568 - 9451525
Alignment:
15 gatagtaga-ctgcaagttgttaacagaacacccatatatataa 57  Q
    ||||||||| |||||||||||||| |||||||||||||||||||    
9451568 gatagtagaactgcaagttgttaatagaacacccatatatataa 9451525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 131 - 211
Target Start/End: Complemental strand, 29280311 - 29280231
Alignment:
131 aacaggcacgttggaaacacaacaatgaagatatgcgctattaaatgcattagatacatgcattggcagactccacaggtt 211  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||    
29280311 aacaggcacgttggaaacacaacaatgaagataagcgttattaaatgcattagatacatgcattggcagactccataggtt 29280231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University