View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_71 (Length: 282)
Name: NF1204_high_71
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 93 - 214
Target Start/End: Original strand, 18629893 - 18630014
Alignment:
| Q |
93 |
ggatgttggtaatgtggagagagagaagattggtgatgatgttgttttgccacaaattggtgttggattctaagaatagagtttgcatggaaatagttga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18629893 |
ggatgttggtaatgtggagagagagaagattggtgatgatgttgttttgccacaaattggtgttggattctaagaatagagtttgcatggaaatagttga |
18629992 |
T |
|
| Q |
193 |
agttggttagatattcttggag |
214 |
Q |
| |
|
||||||||||||| | |||||| |
|
|
| T |
18629993 |
agttggttagataattttggag |
18630014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University