View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_81 (Length: 260)
Name: NF1204_high_81
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 45 - 231
Target Start/End: Complemental strand, 55180737 - 55180551
Alignment:
| Q |
45 |
tgaaatgatatatgtttgtttctacatgcnnnnnnncttttcttaaaaataatatatttgtgatagaatgtatttttggagtaacggataaggtaaaatt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55180737 |
tgaaatgatatatgtttgtttctacatgctttttttcttttcttaaaaataatatatttgtgatagaatgtatttttggagtaacggacaaggtaaaatt |
55180638 |
T |
 |
| Q |
145 |
caaactagtacaatagaatatatggtacctaacgtgatagtaatttgatacgatacaacataatattagttgttcccatctcgacca |
231 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55180637 |
caaactagtacaacaaaatatatggtacctaacgtgatagtaacttgatacgatacaacataatattagttgttcccatctcgacca |
55180551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University