View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_82 (Length: 260)
Name: NF1204_high_82
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 24 - 257
Target Start/End: Original strand, 35195400 - 35195633
Alignment:
| Q |
24 |
tttgttctgattagaaagcagcggctgcgaactagattgaagggcgtattgcaacaaaattacacagaaattagacatatatttttggtaagataagctt |
123 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35195400 |
tttgttctgattaaaaagcagcggctgcgaactagattgaagggcgtattgcaacaaaattacacagaaattagacatatatttttggtaagagaagctt |
35195499 |
T |
 |
| Q |
124 |
gcactagttcaatattaaaaacaaagagataatctgaaatatatatgagtaatctgagctgcagtgttttattttgtcgtaaactcgtattctttcagca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35195500 |
gcactagttcaatattaaaaacaaagagataatctgaaatatatatgagtaatctgagctgcagtgttttattttgtcgtaaactcgtattctttcagca |
35195599 |
T |
 |
| Q |
224 |
accgatgagttcacctcctaatattattcgacat |
257 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| |
|
|
| T |
35195600 |
accgatgagttcacctcctaatattgttcaacat |
35195633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University