View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_84 (Length: 254)
Name: NF1204_high_84
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_84 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 225
Target Start/End: Complemental strand, 29052911 - 29052696
Alignment:
| Q |
10 |
aaacaaaggaaaaacaagtgcagccattactatacatattgttatagcagaagctgttcttgatgatatgtgaaatgctttagccattcctgatacttca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052911 |
aaacaaaggaaaaacaagtgcagccattactatacatattgttatagcagaagctgttcttgatgatatgtgaaatgctttagccattcctgatacttca |
29052812 |
T |
|
| Q |
110 |
tcattattctctccgttttctgttgcagcatgttggtgatgttcattgagctgaatttcttcttttgaaccctcttctccttctgcttctgcaaaagatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052811 |
tcattattctccccgttttctgttgcagcatgttggtgatgttcattgagctgaatttcttcttttgaaccctcttctccttctgcttctgcaaaagatg |
29052712 |
T |
|
| Q |
210 |
ataagctagcaaaagg |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29052711 |
ataagctagcaaaagg |
29052696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University