View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_88 (Length: 252)
Name: NF1204_high_88
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 59 - 224
Target Start/End: Complemental strand, 30662651 - 30662487
Alignment:
| Q |
59 |
ttaagctatataaggggaggattagtaatgctcaaattatttttaaaaaacagactgctagaatcgatctcctaaacacttggtcatagcaatctaatac |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30662651 |
ttaagctatataaggggaggattagtaatgctcaaattatttttgaaaaacagactgctagaattgatctcctaaacacttggt-atagcaatctaatac |
30662553 |
T |
 |
| Q |
159 |
catgtcagggacctaatttcttgttaagttggagcctcaggactggtttgatatccagtacagaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30662552 |
catgtcagggacctaatttcttgttaagttggagcctcaggactggtttgatatccagtacagaaa |
30662487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 30662788 - 30662729
Alignment:
| Q |
1 |
ttttggtgtgattataagttttgacttgatgtggttttgcatgcctagtgctgtaagttt |
60 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30662788 |
ttttggcgtgattataagttttgacttgatgtggttttgcatgcctagtgctgtaagttt |
30662729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University