View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_high_92 (Length: 251)
Name: NF1204_high_92
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_high_92 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 96 - 222
Target Start/End: Original strand, 27511586 - 27511712
Alignment:
| Q |
96 |
catctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggctt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27511586 |
catctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggctt |
27511685 |
T |
|
| Q |
196 |
taaaatagcggtaagaggggcgaagga |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27511686 |
taaaatagcggtaagaggggcgaagga |
27511712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 97 - 213
Target Start/End: Complemental strand, 77584 - 77468
Alignment:
| Q |
97 |
atctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggcttt |
196 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| ||||| || ||||||||| | ||| ||||| ||||| ||||| | |||||||||||||||||| |
|
|
| T |
77584 |
atctacctgatacaagaccattgcggtgagtgtccgcgttttggggcatgccattgatatcaaaagaggcgacagggcttaggagatggggattggcttt |
77485 |
T |
|
| Q |
197 |
aaaatagcggtaagagg |
213 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
77484 |
gaaatagcggtaggagg |
77468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University