View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1204_low_110 (Length: 251)

Name: NF1204_low_110
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1204_low_110
NF1204_low_110
[»] chr7 (1 HSPs)
chr7 (96-222)||(27511586-27511712)
[»] scaffold0016 (1 HSPs)
scaffold0016 (97-213)||(77468-77584)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 96 - 222
Target Start/End: Original strand, 27511586 - 27511712
Alignment:
96 catctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggctt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27511586 catctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggctt 27511685  T
196 taaaatagcggtaagaggggcgaagga 222  Q
    |||||||||||||||||||||||||||    
27511686 taaaatagcggtaagaggggcgaagga 27511712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 97 - 213
Target Start/End: Complemental strand, 77584 - 77468
Alignment:
97 atctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggcttt 196  Q
    |||||||||| |||||||||||||||| |||||| ||||| || ||||||||| |  ||| ||||| |||||  ||||| | ||||||||||||||||||    
77584 atctacctgatacaagaccattgcggtgagtgtccgcgttttggggcatgccattgatatcaaaagaggcgacagggcttaggagatggggattggcttt 77485  T
197 aaaatagcggtaagagg 213  Q
     ||||||||||| ||||    
77484 gaaatagcggtaggagg 77468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University