View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_118 (Length: 235)
Name: NF1204_low_118
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_118 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 23767739 - 23767946
Alignment:
| Q |
17 |
gaatacaaagaaccttttctcctaaacaaagaagatggtttgaaaatcaatcgtaatacaaacaagactctttagacaaaatttaatttaacttatttcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23767739 |
gaatacaaagaaccttttctcctaaacaaagaagacggtttgaaaatcaatcgtaatacaaacaagact-tttagacaaaatttaatttaacttatttca |
23767837 |
T |
 |
| Q |
117 |
tttagcatattattcttgcatttcacttctttcttaacaagatgcttctaatctt---aagnnnnnnncttctaatatggatctcaatacaataaaagtg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23767838 |
tttagcatattattcttgcatttcacttctttcttaacaagatgcttctaatcttaagaagataaaaacttctaatatggatctcaatacaataaaagtg |
23767937 |
T |
 |
| Q |
214 |
gatgaagct |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
23767938 |
gatgaagct |
23767946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University