View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_120 (Length: 227)
Name: NF1204_low_120
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_120 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 29280987 - 29281209
Alignment:
| Q |
5 |
caacttgaacgttagggtttcgtgaatcagcaagtgaaccaatgaacgacgagtgaagtactttaacacggtcgtgtagagatttggagaggattaaaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280987 |
caacttgaacgttagggtttcgtgaatcagcaagtgaaccaatgaacgacgagtgaagtactttaacacggtcgtgtagagatttggagaggattaaaca |
29281086 |
T |
 |
| Q |
105 |
acagtcatttgacagtgaggcgaagactaaaaaggaaaattctcgaagcttctcttcggtagaattaaccgaggagaagagaaattcgagaatttcttgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281087 |
acagtcatttgacagtgaggcgaagactaaaaaggaaaattctcgaagcttctcttcggttgaattaaccgaggagaagagaaattcgagaatttcttgc |
29281186 |
T |
 |
| Q |
205 |
cagtgttgatggttttgataaat |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29281187 |
cagtgttgatggttttgataaat |
29281209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University