View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_123 (Length: 220)
Name: NF1204_low_123
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_123 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 31796630 - 31796774
Alignment:
| Q |
1 |
caaagacatacctgcaagaattttgaggcttcagaagccatgaaatctgtgtatgattgaatatcatactgaaaacgccgaaatggtgtttgagcataag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31796630 |
caaagacatacctgcaagaattttgaggcttcataagccatgaaatctgtgtatgattgaatatcatactgaaaacgtcgaaatggtgtttgagcataag |
31796729 |
T |
|
| Q |
101 |
tattagcaatgtcatcacttcctatgcacactatgtatatgctct |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31796730 |
tattagcaatgtcatcacttcctatgcacactatgtatatgctct |
31796774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 6 - 128
Target Start/End: Complemental strand, 8938403 - 8938281
Alignment:
| Q |
6 |
acatacctgcaagaattttgaggcttcagaagccatgaaatctgtgtatgattgaatatcatactgaaaacgccgaaatggtgtttgagcataagtatta |
105 |
Q |
| |
|
|||||| |||||||| |||||||| | ||||||| || |||||||||||| |||||||||||| | | || | |||||||||||||||||||||| |
|
|
| T |
8938403 |
acatacttgcaagaagtttgaggcatatgaagccaataagtctgtgtatgatcgaatatcatacttcactctcctatatggtgtttgagcataagtattg |
8938304 |
T |
|
| Q |
106 |
gcaatgtcatcacttcctatgca |
128 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
8938303 |
gcaatgtcattacttcctatgca |
8938281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 117
Target Start/End: Complemental strand, 8946686 - 8946650
Alignment:
| Q |
81 |
aaatggtgtttgagcataagtattagcaatgtcatca |
117 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8946686 |
aaatggtgtttgagaataagtattggcaatgtcatca |
8946650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University