View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_124 (Length: 211)
Name: NF1204_low_124
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_124 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 48580012 - 48580128
Alignment:
| Q |
1 |
tattcgaataatccaccgccatggaatatgactaaacagagttgttgggtttgtgagagatggtgatggtgatggtgatgtctttgggtgtgtagtgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48580012 |
tattcgaataatccaccgccatggaatatgactaaacagagctgttgggtttgtgagagatggtgatggtgatggtgatgtctttgggtgtgtagtgaat |
48580111 |
T |
|
| Q |
101 |
atgggttgtctagattg |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48580112 |
atgggttgtctagattg |
48580128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 101
Target Start/End: Original strand, 47030104 - 47030142
Alignment:
| Q |
63 |
gtgatggtgatggtgatgtctttgggtgtgtagtgaata |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47030104 |
gtgatggtgatggtgatgtctttgggtgtgtagtgaata |
47030142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University