View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_128 (Length: 201)
Name: NF1204_low_128
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_128 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 25101572 - 25101754
Alignment:
| Q |
1 |
attttaaagatattcttagtgttggcaagccacgtttgacaaggctggtgactgaaaatctgctgaatgggcttgtgtttcctatattattctcattact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25101572 |
attttaaagatattcttagtgttggcaagccacgtttgacaaggctggtgactgaaaatctgctgaatgggcttgtgtttcctatattattctcattact |
25101671 |
T |
|
| Q |
101 |
agcatcaaagaataatgatgtaagctgagaagacttcctgtaaactagtcaatctttaactttagtttatcttagtcttatac |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25101672 |
agcatcaaagaataatgatgtaagctgagaagacttcctgtaaactagtcaagctttaactttagtttatcttagtcttatac |
25101754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University