View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_34 (Length: 426)
Name: NF1204_low_34
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 13 - 397
Target Start/End: Complemental strand, 28973492 - 28973107
Alignment:
| Q |
13 |
cagagtccagggtaagttgtcaatagcggcttgttcaaataacagctattgcggcgctatggccactatttgacaacattttgtcttttccaattaaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28973492 |
cagagtccagggtaagttgtcaatagcggcttgttcaaataacagctattgcggcgctatggccactatttgacaacattttgtcttttccaattaaaat |
28973393 |
T |
 |
| Q |
113 |
gctagtaattccttataactaacaaacgctcaacttgatcattcaccactcatgagctcaggacnnnnnnnnnnnnnnnnnnn-tatccaagtctatatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
28973392 |
gctagtaattccttataactaacaaacactcaacttgatcattcaccactcatgagctcaggacaaaaaaataaaaaataaaaatatccaagtctatagc |
28973293 |
T |
 |
| Q |
212 |
taaaatcaatcagtgccatccagattccagatcactaaagtaagaaatccagcaaaaaccacaacttcagtaatattataatcttaaataaacatggacc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28973292 |
taaaatcaatcagtgccatccagattccagatcactaaagaaagaaatccagcaaaaaccacaacttcagtaatattataatcttaaataaacatggacc |
28973193 |
T |
 |
| Q |
312 |
atggattgggcagtgtattaattaataatagtgctagtacaacatgttgacagcaaaaacattgtcttgtccaagtagatggggtc |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28973192 |
atggattgggcagtgtattaattaataatagtgctagtacaacatgttgacagcaaaaacattgtcttgtccaagtagatggggtc |
28973107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University