View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_36 (Length: 416)
Name: NF1204_low_36
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 4e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 229 - 330
Target Start/End: Original strand, 693765 - 693866
Alignment:
| Q |
229 |
ttggcctttgtagaagagttcatcagcaggacagagtgtgttggaggatttgcgaggtgaaatggagattgtgaactcaaaatctgaggaagaagatgat |
328 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
693765 |
ttggcctttgtagaagagttcatctgcaggacagagtgtgttggaggatttgcgaggtgaaatggagattgtgaactcaaaatctgaggaagaagatgat |
693864 |
T |
|
| Q |
329 |
ga |
330 |
Q |
| |
|
|| |
|
|
| T |
693865 |
ga |
693866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 79 - 130
Target Start/End: Original strand, 693615 - 693666
Alignment:
| Q |
79 |
gatgaaagaagtggtggaatcattggaggcactgctaccggtggaatcacgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
693615 |
gatgaaagaagtggtggaatcattggaggcgctgctaccggtggaatcacgg |
693666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University