View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1204_low_36 (Length: 416)

Name: NF1204_low_36
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1204_low_36
NF1204_low_36
[»] chr5 (2 HSPs)
chr5 (229-330)||(693765-693866)
chr5 (79-130)||(693615-693666)


Alignment Details
Target: chr5 (Bit Score: 98; Significance: 4e-48; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 229 - 330
Target Start/End: Original strand, 693765 - 693866
Alignment:
229 ttggcctttgtagaagagttcatcagcaggacagagtgtgttggaggatttgcgaggtgaaatggagattgtgaactcaaaatctgaggaagaagatgat 328  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
693765 ttggcctttgtagaagagttcatctgcaggacagagtgtgttggaggatttgcgaggtgaaatggagattgtgaactcaaaatctgaggaagaagatgat 693864  T
329 ga 330  Q
    ||    
693865 ga 693866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 79 - 130
Target Start/End: Original strand, 693615 - 693666
Alignment:
79 gatgaaagaagtggtggaatcattggaggcactgctaccggtggaatcacgg 130  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||    
693615 gatgaaagaagtggtggaatcattggaggcgctgctaccggtggaatcacgg 693666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University