View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_58 (Length: 360)
Name: NF1204_low_58
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 11 - 332
Target Start/End: Complemental strand, 40412036 - 40411715
Alignment:
| Q |
11 |
cacagaagatggcaagtatgaatctcttcccttagaaaatctaccaactgaacaggtagtaaacctagccaaagaagcatcattgaaagctatacaagaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40412036 |
cacagaagatggcaagtatgaatctcttcccttagaaaatctaccaactgaacaggtagtaaacctagccaaagaagcatcattgaaagctttacaagaa |
40411937 |
T |
 |
| Q |
111 |
tggggacaatccatatcagaaatcacacacctcatcttatgcacaacttcttgcttcggcagcgttcccggtccagatactcacctcgccagacttctta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40411936 |
tggggacaatccatatcagaaatcacacacctcatcttatgcacaacttcttgcttcggcagcgttcccggtccagatactcacctcgccagacttctta |
40411837 |
T |
 |
| Q |
211 |
atctcaaaccaaccgttaacagactcatgatttttggtcacggttgccacgccggtggcaccatcctccgtatcgccaaagacatggctgagaataatgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40411836 |
atctcaaaccaaccgttaacagactcatgatttttggtcacggttgccacgccggtggcaccatcctccgtatcgccaaagacatggctgagaataatgt |
40411737 |
T |
 |
| Q |
311 |
cggttcacgtgttcttgctgtt |
332 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40411736 |
cggttcacgtgttcttgctgtt |
40411715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University