View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_65 (Length: 339)
Name: NF1204_low_65
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 24 - 120
Target Start/End: Complemental strand, 47851860 - 47851764
Alignment:
| Q |
24 |
ccacagagcaggtatgaataatataaagtttatttttgactaaagttgtgaataaagtatatatgagtcttttgacttgcatggaaatgatggaatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47851860 |
ccacagagcaggtatgaataatataaagtttatttttgactaaagttgtgtataaagtatatatgagtcttttgacttgcatggaaatgatggaatg |
47851764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 204 - 276
Target Start/End: Complemental strand, 47851680 - 47851610
Alignment:
| Q |
204 |
gagtacagtagtttgcatgtgatgatgatattatatatacttacttatgtgatttcatttcatgtttttcatt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47851680 |
gagtacagtagtttgcatgtgatgatgatattatatata--tacttatgtgatttcatttcatgtttttcatt |
47851610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 325
Target Start/End: Complemental strand, 47851579 - 47851551
Alignment:
| Q |
297 |
tcccaatccacacttttctttctctctgc |
325 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47851579 |
tcccaatccacacttttctttctctctgc |
47851551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University