View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_73 (Length: 313)
Name: NF1204_low_73
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_73 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 30 - 313
Target Start/End: Original strand, 48276904 - 48277197
Alignment:
| Q |
30 |
cttatgtttatgctaattctcaaactcaaaggaaccaactccttacactattcttatgatcgatctcatgccnnnnnnngtttatttattcttaattttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48276904 |
cttatgtttatgctaattctcaaactcaaaggaaccaactccttacactattcttatgatcgatctcatgccttttttc-tttatttattcttaattttg |
48277002 |
T |
 |
| Q |
130 |
aaattaatat---------------attcaaaattgctctgttcagagtattatggtaaataattgtcaccaccaagtatttttctataatccatcctct |
214 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277003 |
aaattaatatcccataactttatatattgaaaattgctctgttcagagtattatggtaaataattgtcaccaccaagtatttttctataatccatcctct |
48277102 |
T |
 |
| Q |
215 |
nnnnnnnctatttttctgcaataaccagtgaatttggttttggtagctataatatatatattttgtcgttgatattcctctaaaatcactagttttagt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277103 |
aaaaaaactatttttctgcaataaccagtgaatttggttttggtagctata----atatattttgtcgttgatattcctctaaaatcactagttttagt |
48277197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University