View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_76 (Length: 307)
Name: NF1204_low_76
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_76 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 84 - 211
Target Start/End: Complemental strand, 9451515 - 9451388
Alignment:
| Q |
84 |
atatgagcatggggaagagagtggatgaatttctgcatgagaacattaacaggcacgttggaaacacaacaatgaagatatgcgctattaaatgcattag |
183 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
9451515 |
atatgagcatggggaagagagtggattaatttctgcatgagaacattaacaggcatgttggaaacacgacaatgaagatagtccctattaaatgcattag |
9451416 |
T |
|
| Q |
184 |
atacatgcattggcagactccacaggtt |
211 |
Q |
| |
|
||| |||||||||||||||||| ||||| |
|
|
| T |
9451415 |
atatatgcattggcagactccataggtt |
9451388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 9451568 - 9451525
Alignment:
| Q |
15 |
gatagtaga-ctgcaagttgttaacagaacacccatatatataa |
57 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
9451568 |
gatagtagaactgcaagttgttaatagaacacccatatatataa |
9451525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 131 - 211
Target Start/End: Complemental strand, 29280311 - 29280231
Alignment:
| Q |
131 |
aacaggcacgttggaaacacaacaatgaagatatgcgctattaaatgcattagatacatgcattggcagactccacaggtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29280311 |
aacaggcacgttggaaacacaacaatgaagataagcgttattaaatgcattagatacatgcattggcagactccataggtt |
29280231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University