View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_81 (Length: 290)
Name: NF1204_low_81
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_81 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 47070219 - 47069954
Alignment:
| Q |
17 |
agtcactcagtcagatcctattcaagttgttttttcactgttagttggtttttcttacatgattaatagtgacaaatatcgaattttgttccagatatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
47070219 |
agtcactcagtcagatcctattcaagttgttttttcactgttagttggtttttcttacctgattaatagtgacaaaaatcgaattttgttccagatagct |
47070120 |
T |
 |
| Q |
117 |
gtttggtttttcatagtacgggttaaaaaccaaaatttgctccacttttatgtttgttgtagttaaaattctggataatttgaaacaatagtaaaattat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47070119 |
gtttggtttttcatagtacgggttaaaaaccaaaatttgctccactttgatgtttgttgtagttaaaattctggataatttgaaacaatagtaaaattat |
47070020 |
T |
 |
| Q |
217 |
gattgatggtgtttctttgatggtatttctttcc-ttttagttacagcaataatgtggagaattat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47070019 |
gattgatggtgtttctttgatggtatttctttcctttttagttacagcaataatgtggagaattat |
47069954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University