View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_83 (Length: 290)
Name: NF1204_low_83
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_83 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 3 - 262
Target Start/End: Original strand, 12892630 - 12892889
Alignment:
| Q |
3 |
ctaagaaacaaaagcttacaaatacgacggaagaatccaagcaaatgagcgttacgaaccatttcacctttctcgtcacgcatcgctttgataaactgta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12892630 |
ctaagaaacaaaagcttacaaatacgacggaagaatccaagcaaatgagcgttacgaaccatttcacctttctcgtcacgcatcgctttgataaactgta |
12892729 |
T |
|
| Q |
103 |
ccatccatatactcgcgtctgnnnnnnnnnnnnnnggaacacgattgagtgaggattgagagggattaggggaattaaggttttgagggatttaccgacg |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12892730 |
ccatccatatactcgcgtctgaaaaaaggaaaaaaggaacacgattgagagaggattgagagggattagggaaattaaggttttgagggatttaccgacg |
12892829 |
T |
|
| Q |
203 |
gcgagtgtttttccggcgagggtttcgacggagacgcggcgaccgacgggggagagtagt |
262 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12892830 |
gcaagtgtttttccggcgagggtttcgacggagacgcggcgaccgacgggggagagtagt |
12892889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University