View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_92 (Length: 266)
Name: NF1204_low_92
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 105 - 237
Target Start/End: Complemental strand, 42863125 - 42862994
Alignment:
| Q |
105 |
aactgtttgaagaaccttgtaattgttgtgatcttcaaagaataaccttgtacnnnnnnnnnnggatagaagaagatccgaagtatgctccgttggtgat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42863125 |
aactgtttgaagaaccttgtaattgttgtgatcttcaaagaataaccttgtacttttttttt-ggatagaagaagatccggagtatgctccgttggtgat |
42863027 |
T |
|
| Q |
205 |
gattgatgaacctcaactcaagttaccttttac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42863026 |
gattgatgaacctcaactcaagttaccttttac |
42862994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University