View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_94 (Length: 264)
Name: NF1204_low_94
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 28670314 - 28670105
Alignment:
| Q |
1 |
atacatacacaaaattcacataaacacaactaggggttaatatgataccccaaacaagaacactcactttagttgagttcaaagttatcaacactaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28670314 |
atacatacacaaaattcacataaacacaactaggggttaatatgataccccaaacaagaacactcactttagttgagttcaaagttatcaacacaaagag |
28670215 |
T |
 |
| Q |
101 |
aattgttgagaggtagaggaagtggtgaagttgaaactggtgatatccccttaaaaagccaatatattgcaacaaaaaatccttatcaaataatgaagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28670214 |
aattgttgagaggtagaggaagtggtgaagttgaaactggtgatatcccctt-aaaagccaatatattgcaacaaaaaatccttatcaaataatgaagca |
28670116 |
T |
 |
| Q |
201 |
cgttgcatgca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
28670115 |
cgttgcatgca |
28670105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University