View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1204_low_98 (Length: 262)
Name: NF1204_low_98
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1204_low_98 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 28249129 - 28248968
Alignment:
| Q |
1 |
attttatatagattatggttcatggcgatgtttcttggaagttatgcaatgtttgttgtggttatgcttattgcaaagtcctttgattttgtaatgttta |
100 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| | ||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28249129 |
attttatatagattatggttcatgacaatgtttgt-ggaagttatgcaatgtttgttgtggttctgcttattccaaagtcctttgattttgtaatgttta |
28249031 |
T |
 |
| Q |
101 |
atatactactgcgaataaatatatatttttatacgtatcggtgggattgacccataaaacaaa |
163 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
28249030 |
atatactactgcgaataaatatatacttttatacgtatcagtgagattgacccatagaacaaa |
28248968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 190 - 262
Target Start/End: Complemental strand, 28248371 - 28248299
Alignment:
| Q |
190 |
tggcgtaaatgcacttttaattcttctattttatcaaactcagaaagtataatttatcacattctcggatatt |
262 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28248371 |
tggcgtaactgcacttttaattcttctattttatgaaactcagaaagtataatttatcacattctcggatatt |
28248299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University