View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12050_high_11 (Length: 368)

Name: NF12050_high_11
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12050_high_11
NF12050_high_11
[»] chr3 (1 HSPs)
chr3 (19-123)||(28539072-28539176)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 123
Target Start/End: Original strand, 28539072 - 28539176
Alignment:
19 tcatgagtggccttggaatctaaaggattgtctcgtgaggtagttttggttctaggggagatttttagagggtgggggtcgttttggtccttgccatgtc 118  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||    
28539072 tcatgagtggcgttggaatctaaaggattgtctcgtgaggtagttttggttctaggagagatttttagagggtgggggtcgttttggtccttgtcatgtc 28539171  T
119 tcttg 123  Q
    |||||    
28539172 tcttg 28539176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University