View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12050_high_13 (Length: 348)
Name: NF12050_high_13
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12050_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 10 - 337
Target Start/End: Original strand, 19326727 - 19327054
Alignment:
| Q |
10 |
gcacagaaacgaaaaccacaaaggaagcttttttcatcaccggttgtaaccatgcttattgttctgattgtgtcgtgctttacgttcgttcaaaaattga |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19326727 |
gcacagaaacgaaaaccactaaggaagcttttttcatcactggttgtaaccatgcttactgctctgattgcgtcgtgctttacgttcgttcaaaaattga |
19326826 |
T |
 |
| Q |
110 |
agaaaatgtgatcaatgtacggtgtcctgaaagtggttgcagtggattattggaagctgaggaatgccgggcgattttacctgtcgaggattttgatcga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19326827 |
agaaaatgtgatcaatgtacggtgtcctgaaagtggttgtagtggattattggaagctgaggaatgccgggcgattttacctgtcgaggattttgatcga |
19326926 |
T |
 |
| Q |
210 |
tggggaaaagctttatgcgaggcgatgtttgatgttaatgagaaattttactgtccatttccggattgttctgcgcttttgattaatgatgggacggagg |
309 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19326927 |
tgggggaaagctttatgcgaggcgatgtttgatgttaatgagaaattttactgtccatttccggattgttctgcgcttttgattaatgatgggacggagg |
19327026 |
T |
 |
| Q |
310 |
ctgtgctgcaatcggagtgtcccaattg |
337 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |
|
|
| T |
19327027 |
ctgttctgcaatcggagtgtccaaattg |
19327054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 235 - 304
Target Start/End: Original strand, 19324808 - 19324877
Alignment:
| Q |
235 |
tgtttgatgttaatgagaaattttactgtccatttccggattgttctgcgcttttgattaatgatgggac |
304 |
Q |
| |
|
||||| ||| |||||| ||||||||||||| |||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
19324808 |
tgttttatgctaatgaaaaattttactgtctatttgcggattgttctacccttttgattaatgatgggac |
19324877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University