View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12050_high_23 (Length: 271)
Name: NF12050_high_23
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12050_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 36867661 - 36867886
Alignment:
| Q |
18 |
ggttcaaacatcttcaagaagataattgatgaagaaacgccaaagggagtgtggcaaagactcaagaaggtgtatggtggcgatgtcaagctcaagaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36867661 |
ggttcaaacatcttcaagaagataattgatgaagaaacgccaaagggagtgtggcaaagactcaagaaggtgtatggtggcgatgtcaagctcaagaaag |
36867760 |
T |
 |
| Q |
118 |
tgaagctccaagccttgtgccatcaccatgagatgctctaaatgaccaagcaaagtcaattgcagagttctaatccaatgaagtttatttgtctttgaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36867761 |
tgaagctccaagccttgtgccatcaccatgagatgctctgaatgactaagcaaagtcaattgcagagttctgatccaatgaagtttatttgtctttgaaa |
36867860 |
T |
 |
| Q |
218 |
tttccaaaatctctttgcttatcatt |
243 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
36867861 |
tttccaaaatctttttgcttatcatt |
36867886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University