View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12050_low_10 (Length: 369)
Name: NF12050_low_10
Description: NF12050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12050_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 19 - 350
Target Start/End: Complemental strand, 47934093 - 47933762
Alignment:
| Q |
19 |
cagagagccgttctagtaaatgagccgttctaggaagggggtccaatcaattggtatattgtgcgctgcttccgtgttgtttacaccagagggtgttctc |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47934093 |
cagagagccattctagtaaatgagccgttctaggaagggggtccaatcaattggtatattgtgcgctgcttccgtgatgtttacaccagagggtgttctc |
47933994 |
T |
 |
| Q |
119 |
aagacctaaatacccttttagttacgtgacagcaactttaccattgcatcaaaactggtatattcgaaaataactgtcaggggtaatggcgaggtagtag |
218 |
Q |
| |
|
||||| |||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47933993 |
aagacttaaatacctttttagttacgtgacaacaactttaccattgcatcaaagctggtatattcgaaaataactgtcaggggtattggcgaggtagtag |
47933894 |
T |
 |
| Q |
219 |
cactaacaatgacgaaaccctcaaccgatgttctagaagggcaacaaatggttaattagaaggcaaaatagaagaatccaatggcgggctcactgacaag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47933893 |
cactaacaatgacgaaaccctcaaccgatgttctagaagggcaacaaatggttaattagaaggcaaaagagaagaatccaatggcgggctcactgacaag |
47933794 |
T |
 |
| Q |
319 |
aacccataaacaaaggtaacagaggagctttt |
350 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
47933793 |
aaaccataaacaaaggtaacagaggagctttt |
47933762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University